rs34355888 chr20:31852885 T>C
- Sequence
gcagcccagaaggtggcgctcttg[T/C]tgaaggcagagtggaatcgtttct
- ASB in cell types
- hepatocytes WA09 (embryonic stem cells) neutrophils THP-1 (acute monocytic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| hepatocytes | -2.03 | 2.08 | 1.12 | |||
| WA09 (embryonic stem cells) | 1.56 | 1.01 | 1.35 | |||
| neutrophils | 0.05 | 2.90 | 1.50 | |||
| THP-1 (acute monocytic leukemia) | 0.87 | 0.95 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.21 | 0.80 | 1.37 |
Items per page:
1 – 5 of 11
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Left_Ventricle, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid