rs34382957 chr8:97867815 C>G
- Sequence
gttaattacaaaacaaagtccgcc[C/G]aaagcaccaaattatcagactgtg
- ASB in cell types
- foreskin keratinocyte GM02610 (Lymphoblastoid Cell Lines) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.51 | -1.39 | 1.50 | |||
| GM02610 (Lymphoblastoid Cell Lines) | -2.15 | 2.42 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | -3.44 | 1.59 | 2.00 |
Items per page:
1 – 3 of 3