rs34383794 chr2:179440642 C>A
- Sequence
tgtctataaatcacaactgaaggt[C/A]caaccaaggttaagtgtaactagt
- ASB in cell types
- KMS-11 (Plasma cell myeloma) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| KMS-11 (Plasma cell myeloma) | n/a | 1.91 | 3.00 | |||
| foreskin keratinocyte | 1.41 | -0.29 | 1.61 |
Items per page:
1 – 2 of 2