rs34403003 chr7:151062989 G>C
- Sequence
gggctgcatacccccgcccttgga[G/C]atcccgatgcccttcaggtccaga
- ASB in cell types
- K562 (myelogenous leukemia) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- MBD4_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MBD4_HUMAN | 1.70 | -0.33 | 1.00 | n/a | n/a | |||
| GCR_HUMAN | 0.51 | 1.68 | 1.04 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pancreas, Testis, Thyroid, Whole_Blood