rs34428063 chr4:7663348 G>C
- Sequence
gagtgattgagtgagtgagtgagt[G/C]agtcagtcagtcagtagactgttg
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- ZNF24_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZNF24_HUMAN | 1.44 | 0.42 | 1.67 | -3.02 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
