rs34444935 chr3:111716141 A>T
- Sequence
tctcgcccccctgccggccataag[A/T]atattgcaagtatgcatgcattcc
- ASB in cell types
- GM17942 (lymphoblastoid cell) GM02630 (Fanconi anemi) TTC-1240 (Rhabdoid tumor of the kidney) HCM (cardiac myocytes)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.32 | 1.35 | 1.39 | n/a | No Hit | |||
| STAG1_HUMAN | 1.27 | 1.14 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2