rs34457264 chr8:11628842 A>G
- Sequence
tgccgagagacagccccagaggcc[A/G]gggctgggattagtgagtggccct
- ASB in cell types
- HepG2 (hepatoblastoma) liver
- ASB for transcription factors
- HNF4G_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4G_HUMAN | 2.03 | -1.06 | 1.00 | -1.67 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
