rs34464972 chr19:10858458 G>A
- Sequence
agcgcctcctggtgggcatgctgc[G/A]taataggaacaggagccatttatt
- ASB in cell types
- CD34+ stem cells-derived erythroblasts MCF7L-P(immortalized breast epithelial cell line) esophagus squamous epithelium upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 2.97 | n/a | 2.00 | |||
| MCF7L-P(immortalized breast epithelial cell line) | -0.09 | 1.44 | 2.00 | |||
| esophagus squamous epithelium | 1.40 | -0.58 | 1.00 | |||
| upper lobe of left lung | 1.59 | 0.23 | 1.08 | |||
| transverse colon | 1.78 | 0.00 | 1.00 |
Items per page:
1 – 5 of 5
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Frontal_Cortex_BA9, Esophagus_Mucosa, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid