rs34466534 chr10:87760431 T>C
- Sequence
cttccccttcgcctttgaccatga[T/C]tgttaagtttcctgaggcctccca
- ASB in cell types
- primary endothelial colony-forming cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary endothelial colony-forming cells | 2.11 | -1.23 | 1.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood