rs34467568 chr7:12111584 G>A
- Sequence
cgtgggagggcctgtggggcctgg[G/A]gttctctctgcgcacgaaatccgg
- ASB in cell types
- tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| tibial nerve | -3.48 | 2.17 | 1.33 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Heart_Atrial_Appendage, Ovary, Pancreas, Skin_Sun_Exposed_Lower_leg, Testis