rs34467595 chr6:110981936 C>G
- Sequence
cggggcaaaaatccgtaaccaaga[C/G]aacagggcgcgattccaatcaaga
- ASB in cell types
- A549 (lung carcinoma) BEAS-2B (bronchial epithelium) neutrophils from periferal blood NRCC
- ASB for transcription factors
- GCR_HUMAN RAD21_HUMAN JUN_HUMAN ZBT40_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GCR_HUMAN | 1.01 | 1.50 | 1.00 | 5.07 | Concordant | |||
| RAD21_HUMAN | -1.90 | 2.69 | 1.25 | n/a | n/a | |||
| JUN_HUMAN | 0.30 | 1.32 | 1.00 | n/a | No Hit | |||
| ZBT40_HUMAN | 0.52 | -0.52 | 1.00 | n/a | No Hit | |||
| RFX1_HUMAN | 1.15 | n/a | 6.00 | -4.08 | Concordant |
Items per page:
1 – 5 of 6
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid