rs34482969 chr2:42053160 G>A
- Sequence
ctggggatggtgggaggagagaga[G/A]ggggaacctgacagtccagccctt
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- PRD10_HUMAN RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRD10_HUMAN | n/a | 2.51 | 2.00 | n/a | n/a | |||
| RARA_HUMAN | 2.25 | -1.83 | 1.00 | -0.62 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Lung