rs34483751 chr15:80054439 C>A
- Sequence
gaagtatgtattttatctcctgga[C/A]cagggtttctcaacatgacatgat
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts CD34+ hematopoietic stem cells
- ASB for transcription factors
- GATA1_HUMAN TIF1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | n/a | 2.50 | 3.00 | 0.04 | Weak Concordant | |||
| TIF1B_HUMAN | -2.15 | 2.95 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
