rs34499346 chr10:80143953 G>A
- Sequence
ctccaggctgcaaagtccaaaagg[G/A]agaaggtattctacaggcgcttca
- ASB in cell types
- GM23338 bipolar neuron HMEC (human mammary epithelial cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.16 | 0.54 | 1.06 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Heart_Left_Ventricle, Lung, Prostate, Skin_Sun_Exposed_Lower_leg