rs34506156 chr8:80099793 A>G
- Sequence
ccaaagtgctgggattacaggcgt[A/G]agccagcgcgcccagctggtctaa
- ASB in cell types
- TMD8 (diffuse large B-cell lymphoma) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- ITF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ITF2_HUMAN | 2.04 | 0.24 | 1.75 | 1.43 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adrenal_Gland, Brain_Anterior_cingulate_cortex_BA24, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood