rs34519622 chr7:2314707 A>G
- Sequence
gacctccggactcgcaggtgcact[A/G]cctcaggcgcaagcctgcacccac
- ASB in cell types
- primary B-CLL cells GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | n/a | 3.37 | 2.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | -0.86 | 1.49 | 1.50 |
Items per page:
1 – 2 of 2