rs34543003 chr4:153143662 T>C
- Sequence
caataaccaggaaggattttggca[T/C]ttggcatttttgcaccttggttct
- ASB in cell types
- K562 (myelogenous leukemia) BIN-67 (Ovarian small cell carcinoma, hypercalcemic type)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.27 | 0.85 | 2.03 | |||
| BIN-67 (Ovarian small cell carcinoma, hypercalcemic type) | 0.82 | 1.40 | 1.00 |
Items per page:
1 – 2 of 2