rs34568686 chr7:106959985 G>A
- Sequence
ggcagctgctgtgagcaccagtgc[G/A]gtgtgccttaggagctgcagcccc
- ASB in cell types
- T-ALL cells from peripheral blood GM18951 (B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| T-ALL cells from peripheral blood | 1.75 | -1.27 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -1.85 | 2.15 | 1.00 |
Items per page:
1 – 2 of 2