rs34576160 chr6:151387412 G>A
- Sequence
aggccataacaacttagtattact[G/A]tgacaacagttttgacttcattga
- ASB for transcription factors
- RFX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RFX1_HUMAN | -1.18 | 2.07 | 1.00 | 3.89 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
