rs34581828 chr15:70192827 G>A
- Sequence
agatccaattctaagagccagggg[G/A]atgcggttcgttttgggctgcatt
- ASB in cell types
- HepG2 (hepatoblastoma)
- ASB for transcription factors
- TEAD3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TEAD3_HUMAN | -1.89 | 2.25 | 1.00 | 4.64 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
