rs34588333 chr16:17251631 G>A
- Sequence
tggtggccgtgagggccactgcac[G/A]gagggcgcttcctgacatgcaggt
- ASB in cell types
- GM12892 (female B-cells lymphoblastoid cell line) TMD8 (diffuse large B-cell lymphoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12892 (female B-cells lymphoblastoid cell line) | -0.49 | 2.02 | 1.00 | |||
| TMD8 (diffuse large B-cell lymphoma) | 2.46 | -1.50 | 2.00 |
Items per page:
1 – 2 of 2