rs346155 chr19:13774313 A>G
- Sequence
tgttcgtaatgtttgaaaactcca[A/G]ctgtgatccactacactacccttg
- ASB in cell types
- HEK293 (embryonic kidney) HCT-116 (colon carcinoma) GM12878 (female B-cells lymphoblastoid cell line) HL-60 (acute myeloid leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.93 | 0.32 | 1.98 | |||
| HCT-116 (colon carcinoma) | 1.21 | 0.08 | 1.11 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 0.73 | 0.57 | 1.14 | |||
| HL-60 (acute myeloid leukemia) | -0.30 | 1.54 | 1.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), hdl cholesterol, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid