rs346670 chr1:119586041 G>A
- Sequence
gccctaggagctggaaatcccaga[G/A]gacagagtccatatgcactgcaac
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells) monocyte-derived dendritic cells
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 1.75 | -0.27 | 3.00 | n/a | No Hit |
Items per page:
1 – 1 of 1