rs347244 chr5:73496192 C>T
- Sequence
agcccagcaggaaagcgtgggagc[C/T]aattacccacatttgccatagaca
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia)
- ASB for transcription factors
- TLE3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TLE3_HUMAN | -0.24 | 2.82 | 2.50 | n/a | n/a |
Items per page:
1 – 1 of 1