rs347515 chr19:43765479 T>G
- Sequence
tgtgaatctgggctctccagcccg[T/G]attcctagcttccggctgggggcc
- ASB in cell types
- K562 (myelogenous leukemia) monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.19 | 0.87 | 1.99 | |||
| monocyte-derived dendritic cells | -1.54 | 2.49 | 2.00 |
Items per page:
1 – 2 of 2