rs348384 chr19:6552375 C>T
- Sequence
ggctctcccaggaggttttcatga[C/T]gtaacctgccaatttgataaatct
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia)
- ASB for transcription factors
- REQU_HUMAN ATF7_HUMAN IKZF1_HUMAN PBX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REQU_HUMAN | 2.72 | -0.59 | 1.50 | n/a | n/a | |||
| ATF7_HUMAN | 2.26 | -3.90 | 1.50 | -1.31 | Weak Concordant | |||
| IKZF1_HUMAN | 1.25 | 0.20 | 1.62 | n/a | n/a | |||
| PBX2_HUMAN | 2.90 | n/a | 2.00 | n/a | No Hit | |||
| MEIS2_HUMAN | 1.48 | n/a | 2.00 | 1.09 | Weak Discordant |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), forward wave amplitude, ldl cholesterol change with statins, maternal transmission distortion, obesity with early age of onset (age >2), refractive error, transmission distortion, triglycerides change with statins