rs348941 chr5:113488469 G>C
- Sequence
cgcgcgaccgcagctggaatccgc[G/C]cggcgcgcaagctgcctgcagccc
- ASB in cell types
- HCT-116 (colon carcinoma) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HCT-116 (colon carcinoma) | 1.42 | 0.36 | 1.00 | |||
| neural cell | 0.97 | 0.07 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Cells_Cultured_fibroblasts, Pituitary, Skin_Sun_Exposed_Lower_leg, Thyroid