rs350129 chr19:917874 C>T
- Sequence
gctctgtcccctgcaggggtcccc[C/T]ccaacctcgaatcttttccctgtg
- ASB in cell types
- K562 (myelogenous leukemia) MCF7L-P(immortalized breast epithelial cell line) Kelly (neuroblastoma) HCT-116 (colon carcinoma)
- ASB for transcription factors
- ZBT7A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZBT7A_HUMAN | 0.21 | 1.75 | 1.94 | n/a | No Hit |
Items per page:
1 – 1 of 1