rs351294 chr5:155069179 C>T
- Sequence
cagaagggagaggaacctggagtt[C/T]tgagaagtgtgtgggaggggaatt
- ASB in cell types
- breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.90 | -5.13 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder in alcoholics, bipolar disorder in non-alcoholics, treatment outcomes for selective serotonin reuptake inhibitors (ssris) - remission at 8 weeks