rs351364 chr1:112502439 A>T
- Sequence
agctaaagctggagacccggctaa[A/T]tgatacaataagttctctaattgc
- ASB in cell types
- iPS-derived dermal fibroblasts
- ASB for transcription factors
- RARA_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RARA_HUMAN | -1.88 | 2.14 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI diastolic blood pressure x smoking status (current vs non-current) interaction (2df test), diastolic blood pressure x smoking status (ever vs never) interaction (2df test), systolic blood pressure x smoking status (current vs non-current) interaction (2df test), systolic blood pressure x smoking status (ever vs never) interaction (2df test)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Lung, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Testis