rs353099 chr15:45631817 T>C
- Sequence
agtgctagctcctcctatcacttc[T/C]tcttcccatcctttaatgatactt
- ASB in cell types
- THP-1 (acute monocytic leukemia) GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF2_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | -0.22 | 2.37 | 1.00 | n/a | n/a | |||
| SPI1_HUMAN | -0.93 | 2.23 | 2.15 | 4.76 | Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GRASP age at death with kuru exposure, aortic valve calcium, asthma, hdl cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood