rs353291 chr5:149431183 T>C
- Sequence
cttaagtcttcgttcgatttggaa[T/C]gcagccagagaacaaatggaaaat
- ASB in cell types
- foreskin keratinocyte GM12890 (Lymphoblastoid Cell Lines) T47D (invasive ductal carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.04 | n/a | 2.67 | |||
| GM12890 (Lymphoblastoid Cell Lines) | 1.19 | -0.52 | 1.00 | |||
| T47D (invasive ductal carcinoma) | -0.70 | 1.16 | 2.41 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, fasting blood glucose, hdl cholesterol change with statins, triglycerides, variant creutzfeldt-jakob disease