rs353730 chr8:56788289 T>G
- Sequence
gagggcctggccactaggggtgca[T/G]catgtgtattgtggccatgactca
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) GM18505 (female B-cells Lymphoblastoid Cell Lines) gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -0.40 | 1.56 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | -1.85 | 2.15 | 1.00 | |||
| gastroesophageal sphincter | 1.99 | -1.66 | 1.00 |
Items per page:
1 – 3 of 3