rs354069 chr7:149625247 G>A
- Sequence
tacttcgaacaataggaatatacc[G/A]gtagatgctacttagcattttcta
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.00 | 0.64 | 1.50 | |||
| HEK293 (embryonic kidney) | -0.03 | 0.68 | 1.97 | |||
| MS-1 (Small cell lung carcinoma) | -0.97 | 0.97 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Prostate, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Spleen, Stomach, Thyroid, Whole_Blood