rs355357 chr1:98131220 C>T
- Sequence
agtgcatagacacagatcccccac[C/T]tccccaatttctcaggcaggcaag
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | n/a | 2.40 | 1.00 | 9.04 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP body mass index (bmi), microalbuminuria, obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio