rs35574 chr16:63789774 T>C
- Sequence
ggagtatcttatgctaattagcag[T/C]gagggcagttgaggattgctttca
- ASB in cell types
- LNCaP (prostate carcinoma) MS-1 (Small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP (prostate carcinoma) | 3.21 | -1.59 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | -3.21 | 2.37 | 1.33 |
Items per page:
1 – 2 of 2