rs356088 chr1:55478898 G>C
- Sequence
aattggcccagtagcttctaaaat[G/C]tacaattaacccatcagtcactag
- ASB in cell types
- glioblastoma cells neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | -2.74 | 1.86 | 1.50 | |||
| neural cell | 1.27 | -0.88 | 1.00 |
Items per page:
1 – 2 of 2