rs35621 chr16:16074751 C>T
- Sequence
cagtttcctcattccacgtccact[C/T]gtagaagagctgagggagaaagtt
- ASB in cell types
- RMG-1
- ASB for transcription factors
- ARI1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARI1A_HUMAN | -1.90 | 2.34 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, cognitive response of healthy volunteers to topiramate treatment as measure by the digit symbol cognitive test, cognitive response of healthy volunteers to topiramate treatment as measure by the symbol search cognitive test, cognitive response of healthy volunteers to topiramate treatment as measure by the trailsb cognitive test, cognitive response to topiramate treatment as measured by the changepc1 (overall cognition) cognitive test, maternal transmission distortion, microalbuminuria, rheumatoid arthritis, sporadic creutzfeldt-jakob disease