rs357735 chr2:71153858 G>A
- Sequence
ctgcggcagcagctgggctcaccc[G/A]ttaagcaagaaggtgaggatggga
- ASB in cell types
- G523NS (glioblastoma)
- ASB for transcription factors
- ASCL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ASCL1_HUMAN | 2.63 | -2.42 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1