rs358007 chr3:55088845 T>C
- Sequence
ctttccctggactttgaaaatcta[T/C]aggctcttctcctgccttcctgtc
- ASB for transcription factors
- RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | -0.26 | 1.82 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP birth weight, hypertension (early onset hypertension), ldl cholesterol, spine bone mineral density (bmd), total cholesterol