rs35941 chr5:54310465 T>C
- Sequence
catgtacagaaacgcctcagttat[T/C]cggagatcagacatccggcagcct
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells lymphoblastoid cell line) CD34+ hematopoietic stem cells-derived proerythroblasts CD14+ monocytes
- ASB for transcription factors
- ATF7_HUMAN PKNX1_HUMAN ETV1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ATF7_HUMAN | -0.11 | 2.53 | 1.50 | n/a | No Hit | |||
| PKNX1_HUMAN | -0.23 | 2.20 | 1.50 | n/a | No Hit | |||
| ETV1_HUMAN | n/a | 2.03 | 2.00 | 3.91 | Concordant | |||
| STAT1_HUMAN | -0.54 | 1.75 | 1.67 | n/a | No Hit | |||
| GATA1_HUMAN | 0.08 | 1.45 | 1.67 | n/a | No Hit |
Items per page:
1 – 5 of 5
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), chronic kidney disease, irritible bowel syndrome, ldl cholesterol, maternal transmission distortion, prop taste detection threshold, salmonella-induced pyroptosis, serum creatinine, systolic blood pressure (sbp), total cholesterol, transmission distortion