rs359895 chr2:184598458 T>A
- Sequence
ctcagtatcagcccagtggctccc[T/A]gccattggctcagtgcaatggacc
- ASB in cell types
- MDA-MB-231 (breast adenocarcinoma) GM02255 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line)
- ASB for transcription factors
- BRD2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD2_HUMAN | -0.01 | 1.31 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1