rs360020 chr5:173782861 A>G
- Sequence
caaaaatgctttgtcacctacaga[A/G]agctgtacacttcatgatatcttt
- ASB in cell types
- K562 (myelogenous leukemia) CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN KDM1A_HUMAN PYGO2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 0.66 | 4.00 | 2.00 | n/a | No Hit | |||
| KDM1A_HUMAN | 0.88 | 0.47 | 2.00 | n/a | n/a | |||
| PYGO2_HUMAN | 2.29 | -0.86 | 2.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, aortic valve calcium, birth weight, fasting insulin, homa-ir, prop taste detection threshold