rs360097 chr1:225878055 C>A
- Sequence
agaggaaaacaccgggataaacaa[C/A]cagggaagaagggaacatccaagt
- ASB in cell types
- HEK293 (embryonic kidney) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.02 | 0.38 | 3.53 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | -0.55 | 1.50 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, birth weight, hypertension (early onset hypertension), ldl cholesterol, stabilized warfarin dose, tetrology of fallot, triglycerides
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Brain_Caudate_basal_ganglia, Brain_Frontal_Cortex_BA9, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis