rs360682 chr1:114954438 G>T
- Sequence
tatttttattctttgtgattttct[G/T]tgcagacatttgtcatcttcagga
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN426_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN426_HUMAN | n/a | 2.76 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), fasting insulin, major depressive disorder, neuroticism, systolic blood pressure (sbp)
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Colon_Sigmoid, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg