rs362408 chr14:73231840 G>A
- Sequence
tcaggtacagaggctgaagccaca[G/A]ggtagatgagaagtgtcccaggag
- ASB in cell types
- MS-1 (Small cell lung carcinoma) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -1.39 | 1.73 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 0.52 | 2.14 | 1.00 |
Items per page:
1 – 2 of 2