rs362895 chr6:146358190 A>C
- Sequence
ttgaaactggcatttttttctaca[A/C]aagacagcgtccccactttctaac
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZN316_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN316_HUMAN | 2.56 | n/a | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, chronic kidney disease, longstanding arthritis, premature ovarian failure, salmonella-induced pyroptosis, schizophrenia