rs365943 chr11:5476569 G>A
- Sequence
tctcttaggtctccagcctaaact[G/A]agaccatcagtatttcatgtattt
- ASB in cell types
- K562 (myelogenous leukemia) IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.17 | 0.87 | 1.99 | |||
| IPSC-derived bipolar neuron | 1.62 | -0.49 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, fasting blood glucose, hdl cholesterol, homa-ir, hypertension (early onset hypertension), ldl cholesterol, total cholesterol