rs36600 chr22:29941597 T>C
- Sequence
ccagtttctttaattttagttagt[T/C]cagtggatgtaaaagggtatctca
- ASB in cell types
- 22RV1 (prostate carcinoma)
- ASB for transcription factors
- ANDR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ANDR_HUMAN | -0.90 | 2.35 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP lung cancer, lung cancer (adenocarcinoma), lung cancer (females), lung cancer (males), lung cancer (small cell carcinoma), lung cancer (squamous cell carcinoma), lung cancer in current smokers, lung cancer in former smokers, lung cancer in never smokers, lung cancer in smokers (pack years of smoking <=25), lung cancer in smokers (pack years of smoking >25), lung cancer with age <=60, lung cancer with age >60
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood