rs366066 - ADASTRA v6.1.1

Sequence: tggggaggtgaggacagcgagggc[T/C]ggacaccacctggtggccctgagc
ASB in cell types: A549 (lung carcinoma) THP-1 (acute monocytic leukemia) GM18526 (B – cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines)
ASB for transcription factors: STAG1_HUMAN RAD21_HUMAN CTCF_HUMAN SMC3_HUMAN
: Search SNPs nearby
View in UCSC Genome Browser
View in PheLiGe
0.05
FDR threshold
0
ES threshold

Transcription factors

Cell types

Uniprot ID	Effect size Ref	Effect size Alt	FDR Ref	FDR Alt	Mean BAD	Motif fold change	Motif concordance
STAG1_HUMAN	-0.16	1.34	1.00	8.3·10^-9	1.18	n/a	n/a
RAD21_HUMAN	0.06	1.31	1.00	3.9·10^-8	1.51	n/a	n/a
CTCF_HUMAN	0.54	1.24	1.00	6.1·10^-7	1.34	0.91	Weak Concordant
SMC3_HUMAN	0.49	1.47	0.81	0.01	1.93	n/a	n/a
STAT1_HUMAN	1.71	-0.69	0.02	1.00	2.00	n/a	No Hit

Items per page:

1 – 5 of 5

CTCF_HUMAN

Weak Concordant

GRASP hdl cholesterol change with statins, irritible bowel syndrome, schizophrenia, total cholesterol

GTEx eQTL Adipose_Subcutaneous, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa